EVOLUTION

Das „Naturgesetz der freien Evolution“ – Grundmechanismus und Fundament des Ökosystems

Das Gefüge sämtlicher Lebensformen der Erde enthält eine Konstante, deren Mechanik folgend hilfsweise als „Naturgesetz der freien Evolution“ bezeichnet wird. Sie besteht darin, dass sich alle Lebensformen bei der evolutionären Veränderung der Merkmale von Generation zu Generation stets vorrangig zu ihrem eigenen nachhaltigen Vorteil und Nutzen anpassen, während es hingegen nicht nachhaltig funktionieren kann, dass eine andere Lebensform die Anpassung der Folgegenerationen zum eigenen vorrangigen Nutzen erzwingt. Weil diese Strategie nicht nachhaltig funktioniert, hat sie sich in der Evolution des ökologischen Gefüges nirgendwo herausgebildet. Und deswegen lässt sich in der gesamten belebten Natur – abseits unserer Wirkungen – kein einziges Beispiel finden, bei dem irgendein Merkmal einer Spezies zum ausschließlichen Nutzen einer anderen Lebensform entstanden ist. Der heutige Mensch hingegen hat sich mit der künstlichen Zuchtwahl diametral gegen dieses zentrale Naturgetz der freien Evololution ausgerichtet und somit seine gesamte Exixtenz auf ein Schema gebaut, das überhaupt nicht nachhaltig funktionieren kann.

Das, was hier als „Naturgesetz der freien Evolution“ bezeichnet wird, wurde im Grunde schon von dem Naturforscher Charles Darwin als zentrale Erkenntnis in die Mitte seiner Theorie gerückt. Er schrieb sogar mehrfach, dass seine gesamte „Theorie vernichtet“ wäre, wenn irgendwo in der Natur auch nur ein einziges Beispiel entdeckt würde, bei dem irgendein Merkmal einer jeglichen Lebensform zum ausschließlichen Nutzen einer anderen Spezies entstanden sei. Folgend ein entsprechendes Original-Zitat aus der zeitgenössischen Übersetzung seines Hauptwerkes „Über die Entstehung der Arten“. (Anm.: In dieser deutschen Fassung wurde die natürliche Selektion zum stetigen eigenen Vorteil der Spezies (natural selection) als „natürliche Zuchtwahl“ übersetzt).

Natürliche Zuchtwahl kann unmöglich irgend eine Abänderung in irgend einer Species bewirken, welche nur einer anderen Species zum ausschließlichen Vortheile gereichte, obwohl in der ganzen Natur eine Species ohne Unterlaß von der Organisation einer andern Nutzen und Vortheil zieht. (…) Ließe sich beweisen, daß irgend ein Theil der Organisation einer Species zum ausschließlichen Besten einer anderen Species gebildet worden sei, so wäre meine Theorie vernichtet, weil eine solche Bildung nicht durch natürliche Zuchtwahl bewirkt werden kann. Obwohl in naturhistorischen Schriften vielerlei Behauptungen in diesem Sinne aufgestellt worden, so kann ich doch keine einzige darunter von einigem Gewichte finden. [1] s. Externe Quelle (google books)

Darwin war sich seiner Sache also äußerst sicher. Und da er recht behalten hat, reicht sein Zitat bereits zur Nachweisführung des behaupteten Naturgesetzes der freien Evolution aus. Bis heute wurde, trotz Millionen von Beschreibungen zu oft extrem komplexen symbiotischen und parasitären Verhältnissen zwischen Viren, Mikroorganismen, Pilzen, Pflanzen und Tieren, kein einziges Beispiel eines noch so kleinen Merkmals irgendeiner Spezies gefunden, das zum ausschließlichen Nutzen einer anderen Art entstanden ist. Warum das so ist, wird bei einer mechanischen Betrachtung der Strukturen der Genome und der Prozesse der Fortentwicklung der Lebewesen im Rahmen der Evolution deutlich.

Das Fehlen der Zucht in der Natur kann nur daran liegen, dass es nicht nachhaltig funktioniert

Eines lässt sich zunächst sicher ausschließen: dass nämlich die Lebensformen auf das Zurechtzüchten anderer Spezies verzichten, weil sie dem „Naturgesetz der freien Evolution“ im Sinne einer „Moral“ gehorchen. Wenn es nachhaltig funktionieren würde, dann wären wohl schon die Reiche der Einzeller seit Milliarden von Jahren eine Welt der gegenseitigen lebenslangen Züchtung und Versklavung und es würde keine „freiwillige“ Grenze geben, was den Grad dieser Manipulationen angeht. So ist etwa der horizontale Gentransfer zwischen Mikroorganismen in der Natur quasi ein Alltagsgeschäft. Und die meisten Viren sind sogar hauptsächlich darauf ausgerichtet, in das Genom ihrer Wirte einzugreifen und es äußerst gezielt und präzise zu manipulieren. Diese Gezieltheit und Präzision verlaufen oft in ganz anderen, sehr viel höheren Dimensionen der Komplexität als unsere relativ geradezu primitive Zucht oder Gentechnik. Warum also kommt es trotzdem in keinem nachgewiesenen Fall zu einer solchen Manipulation, die sich auch gezielt auf die Merkmale der nachfolgenden Generationen des Wirtes beziehen?

Das Naturgesetz der freien Evolution

Ein anschauliches Beispiel zum Begreifen, dass das Fehlen der „Zucht“ in der Natur nichts mit fehlender theoretischer Möglichkeit, Komplexität oder Gezieltheit zu tun hat, ist die Fortpflanzungsstrategie von Viren der seit etwa 300 Millionen Jahren existierenden Familie Baculoviridae: Sie manipulieren Raupen auf äußerst präzise Weise so, dass diese – entgegen ihren gesunden Verhaltensweisen – bis auf die höchsten Gipfel von Bäumen hinaufkrabbeln. Dort angekommen schaltet das Virus den Fressstopp der Raupen aus. Diese blähen sich folglich immer weiter mit nun Virus-gesättigter Körperflüssigkeit auf, bis sie platzen und somit ein abrieselnder Nebel aus Viren entsteht, welcher wiederum die gesunden Raupen in den unteren Regionen der Pflanze infiziert. Diese in Millionen Jahren der evolutionären Selektion entstandene Strategie ist im Genom der Viren genaustens angelegt und übersteigt die Komplexität der künstlichen Wahlzucht des Menschen im Rahmen der Landwirtschaft bei weitem. Würde die gezielte “Zucht” zwischen verschiedenen Lebensformen zur Erlangung von nachhaltigen Vorteilen des Manipulators funktionieren, so müssten sich in der evolutionären Selektion schon auf den Ebenen der Viren und Mikroorganismen vielfältige Formen solcher Strategien entwickelt haben. Aber noch nie wurde auch nur ein einziges, noch so geringfügiges Beispiel gefunden. Alle Parasiten manipulieren immer nur die bestehenden Generationen der Wirte.

Das vollständige Fehlen jeglicher generationsübergreifender Manipulation zwischen verschiedenen Arten in der gesamten Natur lässt in der Umkehr nur einen einzigen möglichen Schluss zu: dass es nämlich nicht nachhaltig funktionieren kann. Und eine Analyse der Mechanismen rund um die parasitären Beziehungen macht den entscheidenden Grund erkennbar: Der Manipulator würde immer eine Schwächung der manipulierten Lebensform bewirken, wenn diese nicht vorrangig zu ihrem eigenen Nutzen selektiert wird. Nur dadurch, dass eine jede Lebensform ohne äußere Manipulation von allen der vielen verschiedenen natürlichen Einflüssen selektiert – man könnte auch sagen „abgeklopft“ – wird, erhält sie ihre nachhaltige Stabilität in dem sich ständig verändernden Gefüge der Umwelteinflüsse.

Der fremde Eingriff in die Evolution einer Spezies führt ausnahmslos immer zur Schwächung

Ein Manipulator könnte zwar über mehrere Generationsfolgen der manipulierten Lebensform hinweg einen eigenen, vielleicht sogar sehr großen Nutzen, etwa durch die Erhöhung der Nahrungsmenge, generieren. Die mögliche Zahl dieser Folgen ist variabel. Sicher aber würde ihm die manipulierte Seite schon ab der ersten dieser Generationen quasi „zwischen den Fingern zerrinnen“, weil sie durch den Entfall der natürlichen Selektion zum eigenen Vorteil und Nutzen stets in irgendwelchen Weisen gegenüber den unzähligen wechselwirkenden und dadurch unbeherrschbar komplexen Einflüssen der Natur geschwächt wird. Da dieser Prozess stetig voranschreitet, werden sich die Vorteile des nun spezialisierten Manipulators an irgendeinem Punkt zwangsläufig in Nachteile für die eigene stabile Beständigkeit verkehren. Da sich der Manipulator spezialisieren musste, ist er abhängig geworden von zunehmend geschwächten Lebensformen und hat sich dadurch von Beginn an dem Ende einer evolutionären Sackgasse genähert – wo seine eigene Erblinie quasi verglühen muss, so wie eine kurze Sternschnuppe.

Es dürfte sehr wahrscheinlich sein, dass sich bei der Möglichkeit einer genausten rückblickenden Beobachtung der irdischen Lebensgeschichte zahlreiche solcher „Sternschuppen“ finden ließen. Das würden zum Beispiel Arten von Viren sein, die auf irgendeine Weise in die Evolution ihrer Wirte, also etwa einer Spezies der Bakterien eingriffen, um sich deren Nachkommen in irgendeiner Weise gefügiger zu machen. Aber da diese neuen Bakteriengenerationen durch die Manipulation zügig schwächer wurden, was ihre Beständigkeit im Gesamtgefüge des ökologischen Systems angeht, starben sie und folglich auch die auf ihre Nutzung spezialisierten Viren wieder aus. Es ist also die natürliche Selektion im Gesamtprozess der biologischen Evolution selbst, die dafür gesorgt hat, dass sich in der gesamten belebten Natur keine Zuchtverhältnisse herausbilden konnten.

Die von außen völlig unbeherrschbare Komplexität eines jeden Genoms

Die eigentliche Mechanik, die dem „Naturgesetz der freien Evolution“ zugrunde liegt ist einfach zu benennen und sie lässt sich auch mathematisch gut nachweisen. Sie besteht darin, dass die Speicherkapazitäten des Erbgutes einer jeden Lebensform, bis hinunter zu den relativ „einfachsten“ Mikroorganismen und sogar den Viren, sehr weit gegen unendlich hoch ist, und dass sie sich über den seit mehreren Milliarden Jahren laufenden Evolutionsprozess mit Informationen gefüllt haben, um eine Organisation zu bilden, die fähig ist, in dem praktisch unendlich komplexen und sich auch noch stetig verändernden Umweltdruck möglichst nachhaltig zu bestehen.

Dabei sind die Informationen, also die „Erbinformationen“, bei allen Lebensformen in einer Abfolge von immer gleichen Molekülen der vier Nukleotid-Basen Adenin, Thymin, Guanin und Cytosin hinterlegt, was abgekürzt wird als A, T, G und C (Anm.: RNA-Viren zur Vereinfachung ausgeklammert). Die Moleküle werden paarweise („Basenpaare“) von verschiedenen Hilfsstoffen gehalten und sie sind in langen Fäden angeordnet, die sich wiederum in sehr platzsparende Pakete wickeln. Das gesamte Gemisch der Nukleotide und der Hilfsstoffe nennt man die „Desoxyribonukleinsäure“, abgekürzt „DNS“ oder, heute gebräuchlicher in englischer Schreibweise, „DNA“. In jeder einzelnen lebendigen Zelle liegen ein oder mehrere solcher Pakete, die als „Chromosomen“ bezeichnet werden. Die Gesamtheit des Erbgutes nennt man das „Genom“, und dieses ist bei mehrzelligen Organismen in jeder einzelnen Körperzelle des Individuums gleich.

Was nun die enthaltenen Informationen an sich angeht, so kann man sich diese einfach vorstellen wie Codes, die innerhalb der variablen Folgen von A, T, G und C liegen. Diese Codes werden von weiteren Zellorganen je nach Bedarf gezielt „ausgelesen“ und dann in verschiedene Funktionen übersetzt. Die bekannteste davon ist die der Bildung von variablen Proteinen, also Eiweißbausteinen. Die physischen Merkmale eines Lebewesens bestehen im Grunde aus sehr vielen verschiedenen solcher Eiweiße und ihr jeweiliger Bauplan ist also im Erbgut codiert. Ganz stark vereinfacht und verkürzt könnte man jetzt also den Gesamtcode des Genoms wie folgt darstellen:

AGGATCCTACGTAGTGACCGTTGTCTAAGTCGACTTGAT

Um zu erkennen, dass es hier wirklich auch im Sinne des Wortes um eine praktisch unbegrenzte, oder aber eben weit gegen unendlich gehende Komplexität geht, eignet sich jene Formel, mit der in der Mathematik die sogenannte „Variation mit Wiederholung“ berechnet wird. Ausgeschrieben lautet sie schlicht so: (n^k). Die Zahl der Sorten von zur Verfügung stehenden Nukleotiden, also A, T, G und C, werden zu „n“ (n=4) und der Platzhalter für die Länge der Reihe ist „k“. Damit kann jetzt recht einfach nachgeschaut werden, wie sich das Ergebnis zu den Möglichkeiten der Variation ändert, wenn die Länge des Genoms, also k, schrittweise vergrößert wird. Folgend zwei Ergebnisse:

n = 4
k = 10
(4^10) = 1.048.576

n = 4
k = 200
(4^200)=
258.224.987.808.691.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000

Das Ergebnis bei k=10 mit etwas über einer Million und somit sieben Ziffern ist wenig spektakulär. Aber bei der Erhöhung auf das 20fache zu k=200 erscheint plötzlich eine unfassbar gigantische Zahl mit fast 100 Stellen. In der Potenzschreibweise mag diese dann mit 258 x 10 hoch 93 vielleicht auf den Laien wieder eher unspektakulär wirken. Es gibt sogar Bezeichnungen für solche großen Zahlen, in diesem Fall würde sie 258 Quindezilliarden lauten.

Sogar die Anzahl aller Atome des Universums verschwindet fast gegenüber der Komplexität selbst der kleinsten Genome

Um was es hier allerdings wirklich geht, lässt sich ansatzweise erahnen, wenn man nun mal nachschaut, was einem anderen Zusammenhang von Astrophysikern als Obergrenze geschätzt wird: nämlich die maximal anzunehmende Zahl sämtlicher Atome des Universums. Gemeint ist damit tatsächlich die Gesamtheit aller atomaren Teilchen, aus denen das gesamte Universum mit all seinen Galaxien und sämtlichen Himmelskörpern besteht. Diese Schätzungen bewegen sich nämlich zwischen 10 hoch 84 und 10 hoch 89. Selbst die höchste angenommene Zahl würde also rund 2,5 Millionen Mal in die errechnete Anzahl der Variationsmöglichkeiten des fiktiven Genoms mit 200 Basenpaaren passen.

Aber nun kommt noch etwas viel Spektakuläreres ins Spiel: Es gibt gar kein auch nur annähernd so „winziges“ Erbgut in der belebten Natur mit „nur“ 200 Basenpaaren. Das kleinste bisher gefundene Bakterien-Genom wurde beim Blattfloh-Endosymbiont Carsonella ruddii mit immerhin fast 160.000 Abfolgen von A, T, G und C nachgewiesen. Würde man nun die Formel mit k=160.000 besetzen, dann käme ein Ergebnis heraus, gegen das die geschätzte Gesamtzahl der Atome des Universums praktisch gegen null gehend verschwindet.

Keine echte Symbiose hat irgendetwas mit züchterischer Manipulation zu tun

Die so weit gegen unendlich reichende Komplexität eines jeden Genoms macht also seine Lenkung von außen unmöglich – jedenfalls im Sinne eines nachhaltigen Prozesses. Nur wenn eine Lebensform sich von Generation zu Generation unter automatischer Berücksichtigung aller Umwelteinflüsse nach dem eigenen Vorteil ausrichtet, kann sie langfristig stabil bleiben. Das gilt auch bei der Entstehung sogenannter „obligatorischer Symbiosen“. Eine solche liegt dann vor, wenn sich zwei oder mehrere Arten so sehr aneinander angepasst haben, dass sie ohne die andere Seite nicht selbstständig überleben könnten. Bekannte Beispiele sind Flechten, bei denen es sich um eine so stark in sich verwachsene obligatorische Symbiose zwischen Algen und Bakterien handelt, dass sie von außen betracht wie eine einzige zusammengeschmolzene Lebensform wirken.

Auch viele in unserem menschlichen Verdauungstrakt lebenden Bakterien sind obligatorische Symbiosepartner unseres Körpers. Wir brauchen sie etwa zur Aufspaltung von Nährstoffen, zur Regulation von Säuren oder zur Abwehr von schädlichen Mikroben. Diese Symbiosepartner tun all das aber niemals, weil unser Körper sie „zurechtgezüchtet“ hat. Sondern sie haben sich meist über Millionen von Jahren der evolutionären Selektion stets zu ihrem eigenen Nutzen „selbstbestimmt“ ausgerichtet, weil unser Körper ihren Lebensraum darstellt, also quasi die „Heimat“ ist und – im Sinne der Nachhaltigkeit – auch die Heimat ihrer Nachkommen sein soll.

Vermeintliche Zuchtverhältnisse in der Natur beruhen immer auf Verdrehungen oder Irrtümern

Manchmal sehen obligatorische Symbiosen oberflächlich betrachtet so aus, als gäbe es doch so etwas wie einen „Züchter“ und einen „Nutzorganismus“. Dies sind aber immer Täuschungen. Besonders häufig findet man diese in der Literatur rund um die Blattschneiderameisen und bestimmte Spezies des Egerschirmlingspilz. Diese beiden Lebensformen haben sich über wahrscheinlich etwa 70 Millionen Jahre der Evolution so stark aneinander angepasst, dass sowohl die Ameisen als auch der Pilz nicht mehr eigenständig existieren könnten. Und weil die Symbiose so abläuft, dass der schon immer unterirdisch lebende Pilz von den Ameisen mit Nährstoffen versorgt wird und er wiederum im Gegenzug kleine, für die Ameisen ideale Nahrung bildende Knöllchen ausprägt, wird dies fehlerhaft dahingehend interpretiert, dass die Ameisen dann ja wohl den Pilz gezielt gezüchtet haben, so wie es der „zivilisierte Mensch“ etwa mit zahlreichen Getreiden, Früchten und Gemüse getan hat.

Die obligatorische Symbiose zwischen Blattschneiderameisen und Egerschirmlingspilz gehört zu den meist erforschten ökologischen Beziehungen überhaupt. Es gibt tausende Studien und viele Wissenschaftler haben Großteile ihrer Arbeit hier investiert. Aber noch nie wurde auch nur ein einziges Merkmal des Pilzes oder der Ameise nachgewiesen, welches zum ausschließlichen Nutzen der jeweils anderen Seite und durch Manipulation derselben entstanden ist. Der Pilz wurde also nicht quasi durch „künstliche Selektion“ von den Ameisen dazu „überrumpelt“ die Knöllchen zu bilden, sondern er hat evolutionär „gemerkt“, dass dieser Aufwand ihm unter dem Strich Vorteile bringt weil er damit die Ameisen anlocken und an sich binden kann.

Umgekehrt wurden aber auch die Ameisen nicht von dem Pilz dazu selektiv gezwungen sich so auszurichten, dass sie ihn im Erdreich versorgen. Sondern jeder Schritt der eigenen Anpassungen erfolgte aus dem „Blickwinkel“ der Symbiosepartner stets vorrangig zum eigenen Nutzen. Es handelt sich dadurch bei echten obligatorischen Symbiosen um einen zeitlich sehr langen Prozess, welcher meist über mehrere oder sogar viele Millionen Jahre verläuft. Und es sind stets nur zwei oder jedenfalls wenige bestimmte Spezies, die sich dabei aufeinander anpassen.

Kein einziger gezüchteter „Nutzorganismus“ des Menschen ist ein Symbiosepartner

Um zu erkennen, dass eine obligatorische Symbiose in der Natur nur oberflächliche Ähnlichkeiten mit den züchterischen Handlungen des Menschen gegenüber den „Nutztieren“ und „Nutzpflanzen“ hat, lassen sich also drei klar benennbare Unterschiede heranziehen:

1. Bei einer echten obligatorischen Symbiose sind stets nur wenige bestimmte Beteiligte sehr spezifisch aufeinander ausgerichtet. Meist handelt es sich um zwei oder höchsten drei Spezies.

2. Die physische und sonstige Ausrichtung der für die obligatorische Symbiose relevanten Merkmale der Partner verläuft über Zeiträume von zumeist mehreren Millionen Jahren.

3. Bei einer echten Symbiose lassen sich auf keiner Seite jegliche Merkmale finden, die von der anderen Seite durch gezielte Manipulation der Generationsfolgen erzeugt wurden.

Da diese Punkte in keinem einzigen Fall der landwirtschaftlichen „Nutzorganismen“ zutreffen, handelt es sich bei der Beziehung des Menschen zu den „Nutztieren“ und „Nutzpflanzen“ in keinem einzigen Fall um eine echte Symbiose. Das was wir mit unseren landwirtschaftlichen Zuchtaktivitäten getan haben, waren also keine symbiotischen, sondern jeweils parasitäre Handlungen. Die „Nutztiere“ und „Nutzpflanzen“ haben durch die Selektion zu unserem Nutzen im Sinne ihrer eigenen nachhaltigen Beständigkeit keinen vorrangigen und erst recht keinen nachhaltigen Nutzen oder Vorteil erlangt. Sondern sie alle sind dadurch schwächer geworden gegenüber den unzählbaren und extrem komplex zusammenspielenden Umwelteinflüssen. Und besonders in der letzten Phase der Intensivierung dieses Selektionsprozesses zum Zwecke der Schaffung von mehr Nutzen für den Menschen, ist die Schwächung entsprechend stark angestiegen.

Die Intensivlandwirtschaft der Gegenwart markiert das Ende der evolutionären Sackgasse

Was wir nun auf den Feldern der Monokulturen oder in den Hallen der Tierhaltungsindustrie beobachten können, sind Organismen, die so schwach sind gegenüber den vielen Komponenten des Umweltdruckes, dass sie mit hohem Aufwand gestützt werden müssen und die mit jeder Generation – zusätzlich beschleunigt bei Erhöhung des Grades der Manipulation – noch schwächer werden. Deswegen bedürfen sie der zunehmenden Gabe etwa von Wasser, Dünger, Insektiziden, Herbiziden, Fungiziden, Antibiotika, Virostatika und vielen sonstigen Hilfestellungen.

Die Phase der Intensivierung ab Mitte des letzten Jahrhunderts hat parallel zu einem kurzzeitigen starken Anstieg der generierten Nahrungsmenge und in der Folge zu einer explosionsartigen Vermehrung des Menschen von etwa drei Milliarden in 1950 auf annähernd acht Milliarden in 2020 geführt. In den nächsten Jahren dieser Sackgassensituation wird es durch die zwangsläufige weitere Schwächung der „Nutzorganismen“ zu einer Eskalation der Verwendung von chemischer Unterstützung zu ihrem Erhalt kommen. Diese Eskalation wird darauf folgend das Ökosystem weiter unter Druck setzen und nicht zuletzt die parasitären Lebensformen sich ihrerseits zu neuen Extremformen selektieren lassen. Insgesamt muss es schon bald zu einem Zusammenbruch dieses völlig widernatürlichen und somit auch instabilen Gefüges kommen.

Dass das „Naturgesetz der freien Evolution“ trotz der äußerst zentralen Bedeutung und seiner Feststellung etwa durch Charles Darwin selbst in den heutigen Naturwissenschaften praktisch keinerlei echte Beachtung findet, lässt sich auf die gleiche Ursache zurückführen, aus der auch die zentrale Regelmäßigkeit der Freiheit ausgeblendet und verdrängt wird. Das Naturgesetz der freien Evolution ist ja sogar die mechanische Grundlage für die Freiheit. Denn dadaurch, dass es keine nachhaltige Möglichkeit der gegenseitigen Züchtung gibt, wird jedes Lebewesen im Sinne des Wortes „frei geboren“ und ein Verklavungsverhältnis zwischen verschiedenen Spezies bleibt ausgeschlossen.

Fazit

Das „Naturgesetz der freien Evolution“ hat seit jeher das Leben auf der Erde geordnet und es beruht auf einer von außen unbeherrschbar hohen Komplexität aller Genome. Es war die Grundlange für die über 500 Millionen Jahre währende Geschichte des höheren Lebens auf dem Planeten mit seiner enormen Vielfalt und Komplexität. Nur in der freien Evolution kann solches entstehen und stabil bleiben. Und zudem ist dieses Naturgesetz das eigentliche Fundament der zentralen Regelmäßigkeit der Freiheit, weil es die gegenseitige Versklavung von verschiedenen Spezies ausschließt. Die sehr breite Ausrichtung des Menschen gegen diese zentralen Naturgesetze und Regelmäßigkeiten ab der „Neolithischen Revolution“ führte das System der Zivilisation in eine evolutionäre Sackgasse. Zahlreiche parallele Zuspitzungen der Gegenwart lassen darauf schließen, dass deren Ende entweder unmittelbar bevorsteht oder dass es sogar bereits erreicht ist.

Quellen:

1) Charles Darwin: Über die Entstehung der Arten durch natürliche Zuchtwahl oder die Erhaltung der begünstigten Rassen im Kampfe um’s Dasein. E. Schweizerbart’sche Verlagshandlung (E. Koch), Stuttgart 1876, Seite 231.